Home » Notizie » La cellula, complessità da emulare per cambiamenti radicali

La cellula, complessità da emulare per cambiamenti radicali

Cellule

Per una più ampia conoscenza del più semplice dei sistemi viventi, di fatto un microcosmo, ma che esemplifica gli organismi più complessi fino a GAIA.

Tutti gli esseri viventi possiedono dei geni che si trovano dentro le loro cellule

Tutti gli organismi, qualunque sia la loro forma, sono costituiti da cellule. Gli organismi più semplici sono formati da una sola cellula, e per questo vengono denominati “organismi unicellulari“. Per esempio tutti i batteri sono degli organismi unicellulari. Invece le piante, gli animali e l’uomo, che sono formati da molte cellule, sono denominati “organismi pluricellulari”. Il tuo corpo, per esempio, contiene circa 100 mila miliardi di cellule !!!!

In principio, tutte le cellule del tuo corpo sono costruite secondo lo stesso modello. Esse sono circondate da un involucro (la membrana cellulare) e possiedono all’interno (nel citoplasma) numerosi altri componenti (organelli cellulari), tra i quali un nucleo cellulare che contiene i geni. I globuli rossi del sangue sono le uniche cellule che non hanno il nucleo.

Le cellule degli animali sono fatte in modo simile a quelle umane. Le cellule vegetali, invece, hanno intorno alla membrana cellulare un involucro più spesso (parete cellulare). Inoltre esse hanno, tra gli organelli, i cloroplasti. A differenza delle cellule umane, animali e vegetali, i batteri sono privi di nucleo cellulare.

La cellula

Le cellule sono molto piccole. Un punto di 2mm sul tuo dito copre circa mille cellule della tua pelle. (Esperimento: osserva le cellule della tua pelle)

Tutti i componenti di una cellula hanno una funzione definita:

Anche se tutte le cellule del tuo corpo sono costruite sullo stesso modello, tu non sei un semplice ammasso di 100 mila miliardi di cellule uguali. Tra questi 100 mila miliardi di cellule si possono distinguere circa 250 tipi di cellule differenti. Ci sono cellule nervose, muscolari, ossee, sanguigne e molte altre ancora. Le cellule sono perfettamente organizzate tra loro, e ognuna adempie a una funzione ben determinata nell’organismo. Le cellule muscolari, per esempio, ti permettono di muoverti, mentre è grazie a quelle nervose che puoi sentire caldo, freddo o dolore. Siccome le cellule hanno compiti diversi, esse hanno forme differenti.

Dentro il nucleo cellulare ci sono i geni

I geni sono contenuti nel nucleo cellulare. Tutti i nuclei di tutte le cellule del tuo corpo contengono gli stessi geni. Una cellula della pelle contiene perciò gli stessi geni di una cellula muscolare o di una cellula nervosa. I geni non sono delle particelle individuali libere dentro il nucleo, ma essi sono impacchettati in quelli che si chiamano i cromosomi.

Quando si osserva un nucleo cellulare al microscopio, non si vede generalmente nient’altro che una macchia scura. Se però la cellula si sta dividendo, allora si possono distinguere i cromosomi, che hanno una caratteristica forma a “X”.

Ci sono 46 cromosomi nel nucleo delle cellule del tuo corpo. Osservando i 46 cromosomi più da vicino, si può notare che ce ne sono sempre due che si assomigliano. Per questo motivo si parla anche di 23 coppie di cromosomi. Le coppie di cromosomi possono essere numerate da 1 a 22.

L’ultima coppia è invece particolare: essa determina il sesso dell’essere umano. Per questa ragione questi due cromosomi sono chiamati “cromosomi sessuali”. Nelle femmine questa coppia è formata da due cromosomi “X”, mentre nei maschi la coppia è formata da un cromosoma “X” e da uno “Y”.

Il numero di cromosomi varia in funzione della specie. Gli esseri umani hanno 46 cromosomi, le scimmie 48, i cani 78, i gatti 38, le zanzare 8 e i cavolfiori 18.

I figli sono metà padre e metà madre

Le cellule dei gameti sessuali, gli ovuli femminili e gli spermatozoi maschili, hanno solo 23 cromosomi. Quando uno spermatozoo paterno si fonde con un ovulo materno si ha la formazione di una nuova cellula: l’ovulo fecondato con 46 cromosomi o 23 coppie di cromosomi.

L’ovulo fecondato si divide successivamente in due cellule, che ripetono a loro volta lo stesso processo formando un embrione di 4 cellule. E così via fino allo sviluppo completo del bambino.

Ora capisci perché i cromosomi sono sempre in coppie: per metà provengono dal padre, e per metà dalla madre. Da un punto di vista genetico un figlio è la combinazione dei suoi genitori, ed è per questo che gli assomiglia.

I cromosomi sono dei filamenti di geni

Ciascuno dei tuoi 46 cromosomi è costituito da un lungo filamento molto sottile che contiene una serie di geni. Chimicamente la sostanza di cui sono composti questi filamenti si chiama Acido DesossiriboNucleico, abbreviato in DNA.

La lunghezza dei tuoi 46 filamenti genetici messi insieme è di due metri. In una cellula umana che non si vede nemmeno ad occhio nudo, il filamento genetico è lungo come un giocatore di basket! E se si uniscono tutti i filamenti genetici di tutte le cellule di un solo essere umano, si raggiunge una lunghezza pari a 100 volte la distanza tra la terra ed il sole.

Il DNA

Il filamento genetico è in realtà composto da due filamenti paralleli uniti tra loro per dei legami trasversali, che si attorcigliano intorno al proprio asse. Immagina una semplice scala a chiocciola: due rampe laterali mantenute insieme per degli scalini. I ricercatori non parlano di scala a chiocciola, ma di doppia elica. Una volta srotolato, il filamento genetico assomiglia ad una scala a pioli.

Come abbiamo appena visto, le caratteristiche di un essere vivente sono scritte nei suoi geni. Ti starai dunque domandando come questo sia possibile. Ci sono delle lettere nel filamento genetico? Praticamente si. Guardando più da vicino ciascuno dei due filamenti, si trovano gli stessi componenti. Queste sostanze sono l’Adenina, la Timina, la Guanina e la Citosina. Esse vengono semplicemente designate, rispettivamente, dalle lettere A, T, G e C. Al contrario del nostro alfabeto, composto dalla A alla Z da 26 lettere, l’alfabeto genetico ha solo quattro lettere. La lingua genetica è la stessa per tutti gli esseri viventi, che si tratti di uomo, animali, piante o batteri.

Le lettere formano delle coppie

I quattro componenti, l’Adenina (A), la Timina (T), la Guanina (G) e la Citosina (C), si assemblano in coppie complementari, come in una serratura a chiave. A fa coppia sempre con T, mentre G

sempre con C. Le altre combinazioni, per esempio A e G, o C e T, non sono possibili. Dunque, conoscendo l’ordine delle lettere su di un filamento si possono facilmente indovinare quelle dell’altro. Per esempio, se su di un filamento si legge ATGGTGCACCTGACT, la sequenza delle lettere sull’altro sarà TACCACGTGGACTGA.

I geni sono dei progetti per la costruzione delle proteine

Nel capitolo precedente abbiamo imparato che il DNA è composto da quattro elementi che sono designati dalle lettere A, T, G e C.

Si può quindi dire che dentro il nucleo di ogni cellula del tuo corpo contiene un libro, scritto con le lettere A, T, G e C. Un gene corrisponde quindi ad una frase di questo libro. Il numero esatto di geni che un essere umano possiede non è ancora certo. Gli esperti stimano un numero di geni compreso tra 20000 e 25000. Insieme rappresentano solo due per cento del nostro patrimonio genetico. I geni non sono composti dallo stesso numero di lettere. Un gene corto conta circa 500 lettere, mentre un gene lungo ne ha diverse migliaia.

In tutte le cellule si trova lo stesso libro, con la stessa successione di lettere. Una particolare cellula legge solo le frasi (geni) che contengono le informazioni che le sono necessarie in un determinato momento, per poter compiere la funzione che ha nel corpo. Una cellula sanguigna, infatti, non legge esattamente le stesse frasi (geni) di una cellula muscolare.

Nel nucleo vengono fatte copie dei geni

Prima che una cellula possa leggere un gene, viene fatta una copia nel nucleo cellulare. I due filamenti di DNA si separano nel punto in cui si trova il gene da leggere, in modo che le coppie A-T e G-C siano disaccoppiate. Poi un duplicatore (chiamato RNA polimerasi), situato nel nucleo, utilizza quindi uno dei due filamenti come stampo per copiare la sequenza di lettere. Questo processo genera dunque una copia del gene. Riprendendo l’esempio del libro, si può dire che la cellula ha fatto la copia di una frase del libro del nucleo.

Una differenza nella sequenza di lettere tra l’originale del gene e la sua copia è che le Timine (T) sono rimpiazzate dall’Uracile (U). La sequenza originale si compone quindi di A, T, G e C, mentre la copia di A, U, G e C. Un’atra differenza tra copia e originale è che quest’ultima non è più composta di DNA, ma bensì di Acido RiboNucleico, o RNA.

Dalla copia del gene viene prodotta una catena di amminoacidi

La copia del gene viene esportata fuori dal nucleo cellulare. Essa viene poi letta dalle fabbriche di proteine della cellula: i ribosomi. I ribosomi leggono la frase (copia del gene) dall’inizio alla fine, leggendo tre lettere per volta. Se una frase è composta, per esempio, da AUGGUGCACCUGACUCCUGAGGAGAAG, i ribosomi leggeranno AUG, GUG, CAC, CUG, ACU, CCU, GAG, GAG, AAG.

Nella copia del gene è scritto come una data proteina deve essere fabbricata. Le proteine sono composte di elementi base chiamati amminoacidi. Esistono 20 amminoacidi diversi; ciascuna tripletta di lettere rappresenta un determinato amminoacido. GUC, per esempio, corrisponde all’amminoacido chiamato “valina”, mentre CAC alla “istidina”. Questo codice permette  alla cellula di tradurre le parole di tre lettere in amminoacidi, e viene detto codice genetico. Quando i ribosomi leggono una frase (copia del gene) per gruppi di tre lettere sanno esattamente quale dei venti amminoacidi è associato ad ogni parola di tre lettere, e qual è la loro sequenza. I ribosomi assemblano gli amminoacidi uno dopo l’altro fino ad ottenere la proteina completa.

Anche un solo errore di scrittura presente nella copia del gene può generare una proteina difettosa. Nel punto dove si trova l’errore di ortografia, i ribosomi inseriranno infatti un amminoacido sbagliato. Questo può avere gravi conseguenze. Per esempio, in una malattia chiamata anemia

falciforme per colpa di una proteina difettosa le cellule sanguigne hanno una forma differente da quella normale, e funzionano peggio di quelle delle persone sane.

Le proteine sono prodotte

Nell’ultimo capitolo abbiamo visto che nelle cellule si trovano i ribosomi, che costituiscono la fabbrica di proteine della cellula e assemblano gli amminoacidi in una catena.

La catena di amminoacidi, poi, si ripiega, ed ecco che la proteina è pronta. Il modo in cui una proteina si ripiega su se stessa dipende dagli amminoacidi che compongono la sua sequenza amminoacidica.

Le cellule contengono il 77% di acqua, il 14% di proteine e il 9% tra DNA, RNA, sali, grassi e zuccheri.

Le proteine costituiscono sia il materiale di costruzione, che gli operai della cellula

Esistono moltissime proteine differenti. Ciascuna adempie ad una funzione ben definita all’interno del corpo. Si possono classificare le proteine in gruppi secondo la loro funzione:

  • Le proteine strutturali sono responsabili di dare la corretta forma alle cellule, ai tessuti e agli organi. Le glicoproteine che si trovano nella membrana cellulare ne sono un esempio;
  • Le proteine protettrici servono alla difesa dell’organismo e della cellula. Per esempio gli anticorpi si fissano ai corpi estranei e agli agenti patogeni inattivandone l’effetto nocivo;
  • Gli enzimi rappresentano il più grande gruppo di proteine. Gli enzimi rendono le reazioni chimiche della cellula più veloci e precise, e quindi possibili. La DNA polimerasi per esempio, che copia e ripara il DNA, è un enzima;
  • Le proteine di trasporto si legano a determinate sostanze e le trasportano. Ad esempio l’emoglobina si trova nei globuli rossi, e trasporta l’ossigeno dai polmoni alle altre parti del corpo;
  • Le proteine contrattili: “contrattile” significa “capace di contrarsi”. Sono così chiamate le proteine responsabili del movimento. Le due proteine più importanti nei muscoli sono l’actina e la miosina.
  • Gli ormoni proteici sono delle proteine che funzionano da messaggeri e de regolatori. Per esempio l’insulina, prodotta dal pancreas e trasportata per via sanguigna verso i muscoli, serve ad abbassare il tasso di zuccheri nel sangue.

Mutazioni

In questo capitolo troverete tutte le informazioni utili sulle mutazioni. Qui trovate ulteriori spiegazioni e dei video relativi ai diversi sotto-capitoli:

Nel capitolo “I geni sono dei progetti per la costruzione delle proteine”, abbiamo imparato come una proteina è prodotta a partire dal suo gene, e quali sono le differenti funzioni che le proteine hanno nel corpo umano. Per avere una buona salute è importante che tutte le proteine del corpo compiano efficacemente la loro funzione. Se una proteina è danneggiata e non può più funzionare correttamente, lo sviluppo di una malattia diventa molto più probabile.

Come si arriva a questo? Una delle ragioni che portano a un funzionamento difettoso delle proteine consiste in errori nei loro progetti di costruzione: il DNA. Questi errori si chiamano mutazioni.

Le mutazioni sono degli errori di scrittura

Come visto nel corso del capitolo “I geni sono dei progetti per la costruzione delle proteine”, il nostro genoma è come un libro scritto con le lettere A, C, G e T. Un gene corrisponde ad una frase precisa del libro. Le mutazioni possono essere viste come degli errori di battitura commessi nella scrittura del genoma.

Tutte le cellule mostrano una notevole somiglianza nella loro organizzazione generale e anche per le funzioni che svolgono. Proprio il criterio delle funzionalità può essere sfruttato per descrivere e classificare le strutture all’interno della cellula.

Strutture come la membrana plasmatica e il nucleo, il citoscheletro e il reticolo endoplasmatico, l’apparato del Golgi, i lisosomi, i vacuoli, i mitocondri e i cloroplasti, operano simultaneamente e si influenzano tra loro.

Quali sono le categorie funzionali sotto cui è possibile raggruppare le numerose strutture di tutte le cellule?

La membrana plasmatica e la parete cellulare, il citoscheletro, le ciglia e i flagelli sono sicuramente delle strutture impegnate nel sostegno, nel movimento e nella comunicazione tra cellule e tra i suoi organelli.

Il nucleo, i ribosomi, il reticolo plasmatico e le altre membrane interne (RER REL) insieme all’apparato del Golgi sono strutture che prendono parte ai processi di sintesi delle molecole, al loro assemblaggio e al successivo trasporto.

I lisosomi, i perossisomi e i vacuoli sono organuli che demoliscono, digeriscono e riciclano molecole e materiali pericolosi per la cellula.

I mitocondri e i cloroplasti sono i responsabili della conversione dell’energia per cellula.

L’integrazione tra tutte queste funzioni e gli organuli che le svolgono, fa sì che la cellula possa essere considerata una straordinaria quanto complessa macchina per la vita.